| Worm gene name: | XK675 |
| Worm sequence name: | ZC373.1 |
| Related human gene: | CBS |
| Associated human disease: | Homocystinuria |
| People involved in this project: |
|
| Left primer sequence: | gaggctgctcaacaaaaagg |
| Right primer sequence: | tgttgaagcttgacgagtgg |
| Size of PCR product: | 935 |
| Brief description: | Homocystinuria is an autosomal recessive disorder of methionine metabolism. Cystathione beta synthase (CBS) is the human gene product that catalyzes the committed step in the conversion of methionine to cysteine. Loss of the normal enzyme results in accumulation of the side product homocysteine with systemic consequences.
Affected infants may show no signs until homocysteine levels accumulate. Homocysteine interferes with collagen cross linking, and patients with this disorder may develop joint and skeletal deformities, lens dislocations of the eye (ectopia lentis). Brain development is also affected and patients have an increase in atheromatous plaques of their artery walls. Vascular complications, such as early heart attack, are a leading cause of mortality. Current treatments include a low-methionine (or low-protein) diet, cysteine supplementation and high dose pyridoxine (vitamin B6) supplementation. The above primers were ordered and an amplicon was successfully synthesized using PCR and demonstrated via gel electrophoresis. |
| Report any problems that might have appeared and any solutions: | |
| Media attachments: |
|
