| Worm gene name: | cua-1 |
| Worm sequence name: | Y76A2A.2 |
| Related human gene: | ATP7A |
| Associated human disease: | Menkes Disease |
| People involved in this project: |
|
| Left primer sequence: | aagctcaaacgaatcgtgct |
| Right primer sequence: | ttagcagcgaggaacgaaat |
| Size of PCR product: | 346 |
| Brief description: | Menkes disease is an X-linked recessive mutation in a gene coding for a Cu(2+)-transporting ATPase. It results in copper deficiency which causes cerebral degeneration and death in infancy. It is also called kinky hair disease since the hair will appear whitish and kinked which can be a means of detecting the disease.
In C. elegans, loss of cua-1 function has been shown to cause uncoordinated or no locomotion and adult and larval lethality. The gene is expressed strongly in the anterior intestine of the adult. Warning: The probe report indicates that resulting siRNAs could target T11F1.7 with 0.92 gene specificity. |
| Report any problems that might have appeared and any solutions: | |
