| Worm gene name: | Col-135 |
| Worm sequence name: | M199.5 |
| Related human gene: | collagen type XXIX alpha 1 |
| Associated human disease: | Dermatitis, Atopic |
| People involved in this project: |
|
| Left primer sequence: | cagggacaggaacaggaaaa |
| Right primer sequence: | tttatcgccctttgatccag |
| Size of PCR product: | 344 |
| Brief description: | Atopic dermatitis (eczema) exhibits a chronic relapsing form of skin inflammation, a disturbance of epidermal barrier function that culminates in dry skin, and sensitization to food and environmental allergens. (OMIM, 2008) |
| Report any problems that might have appeared and any solutions: | This protein doesn't have a high alignment. It was in the pink range. |
