Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Col-135
Worm sequence name:  M199.5
Related human gene:  collagen type XXIX alpha 1
Associated human disease:  Dermatitis, Atopic
People involved in this project: 
Left primer sequence:  cagggacaggaacaggaaaa
Right primer sequence:  tttatcgccctttgatccag
Size of PCR product:  344
Brief description:  Atopic dermatitis (eczema) exhibits a chronic relapsing form of skin inflammation, a disturbance of epidermal barrier function that culminates in dry skin, and sensitization to food and environmental allergens. (OMIM, 2008)
Report any problems that might have appeared and any solutions:  This protein doesn't have a high alignment. It was in the pink range.
View(0) or add comments