| Worm gene name: | sma-2 |
| Worm sequence name: | ZK370.2 |
| Related human gene: | SMAD1 |
| Associated human disease: | prostate cancer |
| People involved in this project: |
|
| Left primer sequence: | acgcggcaagaagatctaaa |
| Right primer sequence: | ccgcactagaagcattcaca |
| Size of PCR product: | 300 |
| Brief description: | SMAD1, the human homolog of the Drosophila gene MAD1 (Mothers Against Decapentaplegic 1), encodes a protein involved in the BMP (bone morphogenic protein) signal transduction pathway. Phosphorylated Smad1 forms a complex with Smad4. This protein complex is translocated to the nucleus to direct the transcription of BMP responsive genes.
BMPs are growth factors involved in embryonic and bone development. Human prostate cancer cells express BMPs and BMP receptors. BMP signaling via Smad1 has been shown to be downregulated in androgen-independent prostate cancers and may also have a role in the development of prostate cancer bone metastases. |
| Report any problems that might have appeared and any solutions: | |
