| Worm gene name: | tsp-8 |
| Worm sequence name: | F33C8.3 |
| Related human gene: | Kangai-1; KAI-1 |
| Associated human disease: | metastasis suppressor |
| People involved in this project: |
|
| Left primer sequence: | tcggtcttggaatatggctc |
| Right primer sequence: | gcatctttgaaagccgtctc |
| Size of PCR product: | 545 |
| Brief description: | tsp-8 is an orthologue to the human metastasis suppressor gene, Kangai-1, or KAI-1. The gene is a member of the tetraspanin superfamily of genes, that codes for transmembrane proteins that span the cell membrane four times. Downregulation of this gene was discovered in human metastatic prostate cancer cells, and was found to suppress metastasis when introduced into rat metastatic prostate cancer cells. Investigation into the downregulation of tsp-8 in C. elegans using RNAi can be used to survey the genome for other interdependent targets. This information can then be used to infer ostensible gene interactions in humans in oncogenic and metastatic pathways. |
| Report any problems that might have appeared and any solutions: | |
