| Worm gene name: | F15D3.1a |
| Worm sequence name: | C3745.1 |
| Related human gene: | DMD (dys-1) |
| Associated human disease: | Duchenne Muscular dystrophy |
| People involved in this project: |
|
| Left primer sequence: | acctcatcatccgtcgactc |
| Right primer sequence: | gacggaatctcgtgtcgaat |
| Size of PCR product: | 374 |
| Brief description: | Duchenne Muscular Dystrophy is an X-linked disorder that causes progressive muscle degeneration. Onset of symptoms occurs between 2-5 years of age and death by 20 years of age from respiratory or cardiac failure. |
| Report any problems that might have appeared and any solutions: | |
