Home | Projects | Login or register:
Username:   Password:

Worm gene name:  F15D3.1a
Worm sequence name:  C3745.1
Related human gene:  DMD (dys-1)
Associated human disease:  Duchenne Muscular dystrophy
People involved in this project: 
Left primer sequence:  acctcatcatccgtcgactc
Right primer sequence:  gacggaatctcgtgtcgaat
Size of PCR product:  374
Brief description:  Duchenne Muscular Dystrophy is an X-linked disorder that causes progressive muscle degeneration. Onset of symptoms occurs between 2-5 years of age and death by 20 years of age from respiratory or cardiac failure.
Report any problems that might have appeared and any solutions: 
View(0) or add comments