| Worm gene name: | lbp-5 |
| Worm sequence name: | W02D3.7 |
| Related human gene: | DHTR (dihydrotestosteron receptor) |
| Associated human disease: | Androgen Insensitivity Syndrome |
| People involved in this project: |
|
| Left primer sequence: | tcccggttttcattccatta |
| Right primer sequence: | ttgcatcaaagaccgaacaa |
| Size of PCR product: | 324 |
| Brief description: | Androgen insensitivity syndrome is a condition that affects sexual development before birth and during puberty. People with this condition are genetically male, with one X chromosome and one Y chromosome in each cell. Because their bodies are unable to respond to certain male sex hormones (called androgens), they may have mostly female sex characteristics or signs of both male and female sexual development.Complete androgen insensitivity syndrome affects 2 to 5 per 100,000 people who are genetically male. Partial androgen insensitivity is thought to be at least as common as complete androgen insensitivity.Mutations in the AR gene cause androgen insensitivity syndrome.About two-thirds of all cases of androgen insensitivity syndrome are inherited from mothers who carry an altered copy of the AR gene on one of their two X chromosomes. The remaining cases result from a new mutation that can occur in the mother's egg cell before the child is conceived or during early fetal development.
DHTR defficiency is the other name used for Androgen Insensitivity Syndrome |
| Report any problems that might have appeared and any solutions: | None |
