| Worm gene name: | Caenorhabditis elegans -dys 1 |
| Worm sequence name: | CE27129 |
| Related human gene: | dys 1 |
| Associated human disease: | Duchenne muscular dystrophy |
| People involved in this project: |
|
| Left primer sequence: | aaaatcatcgtcatcctcgc |
| Right primer sequence: | ttcacaagatgcaagttcgc |
| Size of PCR product: | 324 |
| Brief description: | The dys-1 gene encodes an ortholog of human DMD, which when mutated leads to Duchenne muscular dystrophy |
| Report any problems that might have appeared and any solutions: | Problems in copying and pasting thesequence. |
