Home | Projects | Login or register:
Username:   Password:

Worm gene name:  Caenorhabditis elegans -dys 1
Worm sequence name:  CE27129
Related human gene:  dys 1
Associated human disease:  Duchenne muscular dystrophy
People involved in this project: 
Left primer sequence:  aaaatcatcgtcatcctcgc
Right primer sequence:  ttcacaagatgcaagttcgc
Size of PCR product:  324
Brief description:  The dys-1 gene encodes an ortholog of human DMD, which when mutated leads to Duchenne muscular dystrophy
Report any problems that might have appeared and any solutions:  Problems in copying and pasting thesequence.
View(0) or add comments