Home | Projects | Login or register:
Username:   Password:

Worm gene name:  pdi-2
Worm sequence name:  C07A12.4a.1
Related human gene:  na
Associated human disease:  na
People involved in this project: 
Left primer sequence:  ccgaagacgctgtaaagtcc
Right primer sequence:  agaattccatgattctggcg
Size of PCR product:  351
Brief description:  Protein disulfide isomerase
Report any problems that might have appeared and any solutions: 
View(0) or add comments